IMP3 steps: Binning

Binning is the process of grouping together sequences that are believed to originate from the same microbial genome or a closely related group of genomes within a complex microbial community. This helps organizing the massive mixed dataets that are typically generated by sequencing environmental samples, containing genetic material of thousands of different microorganisms. In IMP3 binning will occur through 3 different binnning tools, MaxBin2, MetaBat2 and Binny.

MaxBin2

MaxBin 2 is an automated binning tool designed to recover individual genomes from metagenomes using assembled contigs. It employs an iterative process to refine the binning results, leveraging information such as tetranucleotide frequencies and marker genes to group contigs into bins, each representing a potential individual genome.

MetaBat2

MetaBat 2 is an advanced tool designed for binning assembled metagenomic sequences into individual genomes. It utilizes algorithms that consider various features of the sequences, such as their composition and coverage across samples, to group contigs into bins. Each bin ideally represents a distinct microbial genome, facilitating the study of microbial diversity and function from complex environmental or host-associated samples. MetaBat 2’s sophisticated approach improves the accuracy and efficiency of metagenome-assembled genome (MAG) reconstruction.

Binny

Binny is an automated binning tool integrated within the IMP framework, designed to facilitate the organization of assembled contigs into coherent bins. These bins are intended to represent the genomic content of individual microbial species or strains present in a complex microbial community

Binning Input

Binning takes as input the assembled contigs generated by the IMP pipeline. These contigs are the result of co-assembly processes that integrate metagenomic and metatranscriptomic data to produce comprehensive genomic representations of the microbial community.

You can also use your own assembled contigs but have to pay attention to the contig quality and length, as short or poor-quality contigs may not be accurate and lead to fragmented or mixed bins.

The contigs are generated in FASTA Format, usually denoted by the .fasta or .fa extension, which would look like this:

>contig-0001 length=1500
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG
...
>contig-0002 length=2450
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
GCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
...